View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9768_low_21 (Length: 219)
Name: NF9768_low_21
Description: NF9768
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9768_low_21 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 162; Significance: 1e-86; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 162; E-Value: 1e-86
Query Start/End: Original strand, 39 - 204
Target Start/End: Original strand, 44641821 - 44641986
Alignment:
| Q |
39 |
cagaagaggtttcaatatgggggataccactcctcgcagacgatagaaccgacgtgattctgttgaagtttctccgagccagagacttcaaagtgaaaga |
138 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44641821 |
cagaagaggtttcaatatgggggataccactcctcgcagacgatagaaccgacgtgattctgttgaagtttctccgagccagagacttcaaagtgaaaga |
44641920 |
T |
|
| Q |
139 |
agcattcacaatgatcaagaacactatccgttggagaaaagagttcaaaatcgaagagctgttatt |
204 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
44641921 |
agcattcacaatgatcaagaacactatccgttggagaaaagagttcaaaatcgaagagttgttatt |
44641986 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 38; Significance: 0.000000000001; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 59 - 180
Target Start/End: Original strand, 39893309 - 39893430
Alignment:
| Q |
59 |
gggataccactcctcgcagacgatagaaccgacgtgattctgttgaagtttctccgagccagagacttcaaagtgaaagaagcattcacaatgatcaaga |
158 |
Q |
| |
|
|||||||||||||| || ||||| | || ||||| ||||||||||| ||||| || || ||||| || || || ||||| || |||||||||||||||| |
|
|
| T |
39893309 |
gggataccactccttgctgacgaaacaagtgacgtaattctgttgaaatttctgcgtgcaagagattttaaggtcaaagaggctttcacaatgatcaaga |
39893408 |
T |
|
| Q |
159 |
acactatccgttggagaaaaga |
180 |
Q |
| |
|
|||| || | ||||||||||| |
|
|
| T |
39893409 |
acacaattctctggagaaaaga |
39893430 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University