View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9769_low_4 (Length: 221)
Name: NF9769_low_4
Description: NF9769
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9769_low_4 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 209; Significance: 1e-114; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 209; E-Value: 1e-114
Query Start/End: Original strand, 1 - 213
Target Start/End: Original strand, 37497791 - 37498003
Alignment:
| Q |
1 |
tcaactaagattttcattgtggtttctgttgcgatcattgatattgtagagaattgctgtcaaatgtggctgataaggtctaattcgcagccagagatat |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37497791 |
tcaactaagattttcattgtggtttctgttgcgatcattgatattgtagagaattgctgtcaaatgtggctgataaggtctaattcgcagccagagatat |
37497890 |
T |
 |
| Q |
101 |
taaaaccttgatgttgtaacccaaattgcagtcgtgagtgggctagtggataggcattggtcattcaaataacattttcattgtttatttccaactacaa |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37497891 |
taaaaccttgatgttgtaacccaaattgcagtcgtgagtgggctagtggataggcattggtcattcaaataacattttcattgtttatttccaactacaa |
37497990 |
T |
 |
| Q |
201 |
tcatatctctgct |
213 |
Q |
| |
|
|||||||| |||| |
|
|
| T |
37497991 |
tcatatctatgct |
37498003 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 28 - 77
Target Start/End: Complemental strand, 32618778 - 32618729
Alignment:
| Q |
28 |
gttgcgatcattgatattgtagagaattgctgtcaaatgtggctgataag |
77 |
Q |
| |
|
|||||||| |||||||||||||| ||||| |||||||| |||||||||| |
|
|
| T |
32618778 |
gttgcgatatttgatattgtagagtattgcagtcaaatgcggctgataag |
32618729 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University