View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9770_low_5 (Length: 330)
Name: NF9770_low_5
Description: NF9770
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9770_low_5 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 306; Significance: 1e-172; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 306; E-Value: 1e-172
Query Start/End: Original strand, 7 - 320
Target Start/End: Complemental strand, 5047503 - 5047190
Alignment:
| Q |
7 |
agtatttcataaatatcctgaaggacaatatcagtattgtgaaggaactcccgcctgatataaaatctctggatgtggaagcaattggtagccaggttta |
106 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5047503 |
agtatttcataaatatcctgaaggacgatatcagtattgtgaaggaactcccgcctgatataaaatctctggatgtggaagcaattggtagccaggttta |
5047404 |
T |
|
| Q |
107 |
tgatcttatatatccaatcaatttacttgagatcaatgcttgcagtgttataacaatatcagtatttaaacaccttgcattttagattacagatgcagtt |
206 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5047403 |
tgatcttatatatccaatcaatttacttgagatcaatgcttgcagtgttataacaatatcagtatttaaacaccttgcattttagattacagatgcagtt |
5047304 |
T |
|
| Q |
207 |
cttgcaaaggaggccacagttgctgactatatcaaaattgtacttcctcttcttttgaaaaatagagctgttcacttccttggatatgcaaatcgacttg |
306 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
5047303 |
cttgcaaaggaggccacagttgctgactatatcaaaattgtacttcctcttcttttgaaaaatagagttgttcacttccttggatatgcaaatcgacttg |
5047204 |
T |
|
| Q |
307 |
gttttgatcctatg |
320 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
5047203 |
gttttgatcctatg |
5047190 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University