View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9770_low_7 (Length: 298)
Name: NF9770_low_7
Description: NF9770
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9770_low_7 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 252; Significance: 1e-140; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 252; E-Value: 1e-140
Query Start/End: Original strand, 1 - 283
Target Start/End: Original strand, 4926213 - 4926496
Alignment:
| Q |
1 |
tgggaagattgaagaaaattattcccctctattttgatggcagcata-gcatttgtataactgaaaaaagagattgtaattggctatttacaagaggagg |
99 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||||||| ||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
4926213 |
tgggaagattgaagaaaattattcccttctattttgatggcagcatatgcatttgtataactgaaaaaagagattgttattggctatttacaagaggagg |
4926312 |
T |
 |
| Q |
100 |
ataagaccagatttgattttttgtaatattgtaggatattcacgaaatttgagataaagggattattttatcttagatttaaataggcattggttgctag |
199 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
4926313 |
ataagaccagatttgattttttgtaatattgtaggatattcactaaatttgagataaagggattattttatcttagatttaattaggcattggttgctag |
4926412 |
T |
 |
| Q |
200 |
gttgcatcacagtaaatttaaataggattttatcttagaattaaaaggtaacagaataatgaagatttagtttaactggataat |
283 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| ||||||||||||||||||||||||| |
|
|
| T |
4926413 |
gttgcatcacagtaaatttaaataggattttatcttagaattaaaaggtaatagaatattgaagatttagtttaactggataat |
4926496 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University