View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9770_low_9 (Length: 250)
Name: NF9770_low_9
Description: NF9770
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9770_low_9 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 174; Significance: 1e-93; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 174; E-Value: 1e-93
Query Start/End: Original strand, 1 - 243
Target Start/End: Original strand, 6203177 - 6203423
Alignment:
| Q |
1 |
tattttttaacgtctgtcattggcacttttaaaattggttaaactgacataaaaaacaattgaattgattttaatagtgtctgcgataactaattgtcgt |
100 |
Q |
| |
|
||||||||||||||||| |||| ||||| |||||| ||||||||||| |||||||||||||||||||||||||||||||||| |||||| ||||| |||| |
|
|
| T |
6203177 |
tattttttaacgtctgttattgacacttctaaaatcggttaaactgatataaaaaacaattgaattgattttaatagtgtctacgataattaattatcgt |
6203276 |
T |
|
| Q |
101 |
tgaaaaatgtagagcggcaatt----gccattaatataagggagaagaaatattttcctcattggatctagtgggagctaaattatgttagatggtagtt |
196 |
Q |
| |
|
|||||||| | ||||||||||| |||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6203277 |
tgaaaaatatcgagcggcaattaactgccattaatataagggagaagaaatattttcctcatcggatctagtgggagctaaattatgttagatggtagtt |
6203376 |
T |
|
| Q |
197 |
atgtgtgaggtgtattagcaattgtagtattgcattgacctttgcta |
243 |
Q |
| |
|
|||||| |||||||||||||||| ||| ||||||||||||||||||| |
|
|
| T |
6203377 |
atgtgtcaggtgtattagcaattatagaattgcattgacctttgcta |
6203423 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University