View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9771_high_11 (Length: 275)
Name: NF9771_high_11
Description: NF9771
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9771_high_11 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 220; Significance: 1e-121; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 220; E-Value: 1e-121
Query Start/End: Original strand, 17 - 264
Target Start/End: Complemental strand, 34761460 - 34761213
Alignment:
| Q |
17 |
tttgtctgttattatgaatcaatttgtttctgtaataataagttcgagtgatcaataacctgctttgcacttttctattgtttttatagtgcagttccct |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34761460 |
tttgtctgttattatgaatcaatttgtttctgtaataataagttcgagtgatcaataacctgctttgcacttttctattgtttttatagtgcagttccct |
34761361 |
T |
 |
| Q |
117 |
gttttgaataatattagtcgactagacaagtacaatcaccaaattagtcgttaactttgtagcaccctctcaaatagacccttgagattaatatttcaaa |
216 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||| ||||||||| | ||||||||||||||||||||||| |||||||||| |
|
|
| T |
34761360 |
gttttgaataatattagtcgactaaacaagtacaatcaccaaattagtcgttgactttgtagtaagctctcaaatagacccttgagattgatatttcaaa |
34761261 |
T |
 |
| Q |
217 |
aagattccctattctattaaactgtacggttgatcctattattcctat |
264 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
34761260 |
aagattccctattctattaaactgtacggttgatccaattattcctat |
34761213 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 32; Significance: 0.000000006; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 155 - 206
Target Start/End: Original strand, 6556467 - 6556518
Alignment:
| Q |
155 |
ccaaattagtcgttaactttgtagcaccctctcaaatagacccttgagatta |
206 |
Q |
| |
|
||||||||||| ||||||||| || || ||||||||||||||| |||||||| |
|
|
| T |
6556467 |
ccaaattagtctttaactttgcaggacactctcaaatagacccctgagatta |
6556518 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University