View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9771_high_16 (Length: 254)
Name: NF9771_high_16
Description: NF9771
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9771_high_16 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 125; Significance: 2e-64; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 125; E-Value: 2e-64
Query Start/End: Original strand, 47 - 212
Target Start/End: Complemental strand, 16594619 - 16594458
Alignment:
| Q |
47 |
tcatatattttcttgta-gtggttgctgaccattaagtaagcacgaattgcatttatataatttgattctcattaaaagtgattgaacatgaaattagca |
145 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16594619 |
tcatatattttcttgtatgtggttgctgaccattaagtaagcacgaattgcatttatataatttgattctcattaaaagtgattgaacatgaaattagca |
16594520 |
T |
|
| Q |
146 |
tttttatttttaatattagc-aattgtttgagatttgagattgactttgcaacagcattcaagaatta |
212 |
Q |
| |
|
|| |||||||||||| |||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
16594519 |
tt------tttaatattagcaaattgtttgagatttgagattgcctttgcaacagcattcaagaatta |
16594458 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 195 - 241
Target Start/End: Complemental strand, 16593519 - 16593473
Alignment:
| Q |
195 |
aacagcattcaagaattagacccagttgtgttctttatcttcatttc |
241 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16593519 |
aacagcattcaagaattagacccagttgtgttctttatcttcatttc |
16593473 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University