View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9771_high_20 (Length: 250)
Name: NF9771_high_20
Description: NF9771
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9771_high_20 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 234; Significance: 1e-129; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 234; E-Value: 1e-129
Query Start/End: Original strand, 1 - 246
Target Start/End: Complemental strand, 37584520 - 37584275
Alignment:
| Q |
1 |
atggttgatcctatttcatctccctcattccacggttaattctgagcaatgagcatgtcactaaagttgtatttgtcagcacctctcactgagcatgtcc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37584520 |
atggttgatcctatttcatctccctcattccacggttaattctgagcaatgagcatgtcactaaagttgtatttgtcagcacctctcactgagcatgtcc |
37584421 |
T |
 |
| Q |
101 |
ttgatcccacgctaaaatatttatgttttcttaacaataatagcaaactatatagcatccaacctatcatcataactcaaatattaatttaatctcacaa |
200 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37584420 |
ttgatcccacggtaaaatatttatgttttcttaacaataatagcaaactatatagcatccaatctatcatcataactcaaatattaatttaatctcacaa |
37584321 |
T |
 |
| Q |
201 |
ataatcaaaatacagttatttattatcaacggtgttcatctctctc |
246 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
37584320 |
ataatcaaaatacagttatttattatcaacggtgttcatttctctc |
37584275 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University