View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9771_high_22 (Length: 249)
Name: NF9771_high_22
Description: NF9771
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9771_high_22 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 213; Significance: 1e-117; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 213; E-Value: 1e-117
Query Start/End: Original strand, 18 - 247
Target Start/End: Complemental strand, 36949295 - 36949070
Alignment:
| Q |
18 |
gcaaggtttgatacccctctctcccttgtcttttcaatgtttccaatcaatagcatacaatttatctgattttttgtgaagctatctaatttgcttaaga |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36949295 |
gcaaggtttgatacccctctctcccttgtcttttcaatgtttccaatcaatagca----atttatctgattttttgtgaagctatctaatttgcttaaga |
36949200 |
T |
 |
| Q |
118 |
taatttcaggttattgtcttgaatatggatttatcacttaagcaagcatttcatattctttatgaacaggtaagttctcccctccttcattacactattt |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36949199 |
taatttcaggttattgtcttgaatatggatttatcacttaagcaagcatttcatattctttatgaacaggtaagttctcccctccttcattacactattt |
36949100 |
T |
 |
| Q |
218 |
acatgaggtgttattcatcaattcttcttc |
247 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
36949099 |
acatgaggtgttattcatcaattcttcttc |
36949070 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 39; Significance: 0.0000000000004; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 18 - 133
Target Start/End: Original strand, 10818623 - 10818728
Alignment:
| Q |
18 |
gcaaggtttgatacccctctctcccttgtcttttcaatgtttccaatcaatagcatacaatttatctgattttttgtgaagctatctaatttgcttaaga |
117 |
Q |
| |
|
|||||||||||||| ||||||| | | || ||||||||||||| ||||||||| |||||| |||||||| ||||||||| |||||||||||| |
|
|
| T |
10818623 |
gcaaggtttgatacacctctcttc--tctcccttcaatgtttccattcaatagca----atttatttgatttttagtgaagcta----atttgcttaaga |
10818712 |
T |
 |
| Q |
118 |
taatttcaggttattg |
133 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
10818713 |
taatttcaggttattg |
10818728 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University