View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9771_low_27 (Length: 331)
Name: NF9771_low_27
Description: NF9771
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9771_low_27 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 276; Significance: 1e-154; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 276; E-Value: 1e-154
Query Start/End: Original strand, 15 - 326
Target Start/End: Complemental strand, 24062845 - 24062531
Alignment:
| Q |
15 |
aattcatctaagctttctcttgattgttcccat-ggtcgcctgggtgattcatcccttgagatgacgagggaatcaaagaagttttcccaagtaattatg |
113 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24062845 |
aattcatctaagctttctcttgattgttcccattggtcgcatgggtgattcatcccttgagatgacgagggaatcaaagaagttttcccaagtaattatg |
24062746 |
T |
|
| Q |
114 |
tacggggtgttcattattggcatgtttactgggaacacgttgaagtctttggtaacatttgcattgtttactttcgttggtcgcgagagactcaaatttg |
213 |
Q |
| |
|
|||||||||||||||||||||||||| | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24062745 |
tacggggtgttcattattggcatgttcattgggaacacgttgaagtctttggtaacatttgcattgtttactttcgttggtcgcgagagactcaaatttg |
24062646 |
T |
|
| Q |
214 |
ccatttctttatgggaaagcatttctcgtgtactac--ctgatttcctcgttagatgaggatctcgagggcatccttttggtgtattcaatcattagtaa |
311 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24062645 |
ccatttctttatgggaaagcatttctcgtgtactacctctgatttcctcgttagatgaggatctcgagggcatccttttggtgtattcaatcattagtaa |
24062546 |
T |
|
| Q |
312 |
cgtgcctttgctact |
326 |
Q |
| |
|
||||| |||| |||| |
|
|
| T |
24062545 |
cgtgcatttggtact |
24062531 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University