View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9771_low_37 (Length: 303)
Name: NF9771_low_37
Description: NF9771
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9771_low_37 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 214; Significance: 1e-117; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 214; E-Value: 1e-117
Query Start/End: Original strand, 1 - 290
Target Start/End: Original strand, 2203236 - 2203511
Alignment:
| Q |
1 |
tgtttttggtttttatctcctttggtgctgtttcagttattatgtacataccaaaaactggaaaggacaaattttgcacttcaacattgaatcatgaata |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
2203236 |
tgtttttggtttttatctcctttggtgctgtttcagttattatgtacataccaaaaactggaaaggacaaattttgcacttgaacattgaatcatgaata |
2203335 |
T |
 |
| Q |
101 |
tggaataattattttttatctgcaaggtacatgttaatattttagatttcaacggtttatcttctctcttttaccgtcgcgacactaaatatttctatgc |
200 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||| ||| ||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
2203336 |
tggaataatt-ttttttatctgcaaggtacatgttaattttt-------------tttatcttctctcttttactgtcgcgacactaaatatttctatgc |
2203421 |
T |
 |
| Q |
201 |
agccagacctaaaaattttgttgtcttgagcgaatcaataaacttgtatcgtaaaaataattattttggcactcttaaaaaatgatgtcc |
290 |
Q |
| |
|
| |||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
2203422 |
aaccagacctaaaaattttgctgtcttgagcgaatcaataaacttgtatcgtaaaaataactattttggcactcttaaaaaatgatgtcc |
2203511 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University