View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9771_low_38 (Length: 296)
Name: NF9771_low_38
Description: NF9771
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9771_low_38 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 116; Significance: 5e-59; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 116; E-Value: 5e-59
Query Start/End: Original strand, 19 - 167
Target Start/End: Complemental strand, 42746752 - 42746602
Alignment:
| Q |
19 |
catcacacattcaacgttgttgtttctaatgtcactttcttttcttcttctaatgtttctgtcacactgatacaa--nnnnnnnngtttgctttaacggc |
116 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
42746752 |
catcacacattcaacgttgttgtttctaatgtcactttcttttcttcttctaatgtttctgtcacactgatacaattttttttttgtttgctttaacggc |
42746653 |
T |
|
| Q |
117 |
aacattgtttgattaaagtaccttgaagtttgtgtccactgtccatttcta |
167 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42746652 |
aacattgtttgattaaagtaccttgaagtttgtgtccactgtccatttcta |
42746602 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 64; E-Value: 5e-28
Query Start/End: Original strand, 217 - 280
Target Start/End: Complemental strand, 42746550 - 42746487
Alignment:
| Q |
217 |
gaaacatttcttttcttctgggtagttgatttaacaattcagatgggttctagcaattgatttt |
280 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42746550 |
gaaacatttcttttcttctgggtagttgatttaacaattcagatgggttctagcaattgatttt |
42746487 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University