View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9771_low_44 (Length: 273)
Name: NF9771_low_44
Description: NF9771
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9771_low_44 |
 | |
|
| [»] scaffold0384 (2 HSPs) |
| | |
|
| [»] scaffold0079 (2 HSPs) |
| | |
|
Alignment Details
Target: scaffold0384 (Bit Score: 97; Significance: 1e-47; HSPs: 2)
Name: scaffold0384
Description:
Target: scaffold0384; HSP #1
Raw Score: 97; E-Value: 1e-47
Query Start/End: Original strand, 161 - 265
Target Start/End: Original strand, 4826 - 4930
Alignment:
| Q |
161 |
gaaagaggtgatttgagttacccatttgtgacgcttgtgagatattcaaagatggacattcctgataagtacaatcatcatatatacgctttgaactctc |
260 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
4826 |
gaaagaggtgatttgagttacccatttgtgacgcttgtgagatattcaaagacggacattcctgataagtacaatcatcatatgtacgctttgaactctc |
4925 |
T |
|
| Q |
261 |
tgctc |
265 |
Q |
| |
|
||||| |
|
|
| T |
4926 |
tgctc |
4930 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0384; HSP #2
Raw Score: 75; E-Value: 1e-34
Query Start/End: Original strand, 17 - 95
Target Start/End: Original strand, 4682 - 4760
Alignment:
| Q |
17 |
agggtgaggatattttaatatgctgtaaggtaatacaccattacagcattgggaaaacttactttcactttcctaatct |
95 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4682 |
agggtgaggatattttaatatgctgtaagttaatacaccattacagcattgggaaaacttactttcactttcctaatct |
4760 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0079 (Bit Score: 63; Significance: 2e-27; HSPs: 2)
Name: scaffold0079
Description:
Target: scaffold0079; HSP #1
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 17 - 90
Target Start/End: Original strand, 7200 - 7274
Alignment:
| Q |
17 |
agggtgaggatattttaatatgctgtaaggtaatacaccattacagcatt-gggaaaacttactttcactttcct |
90 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
7200 |
agggtgaggatattttaatatgctgtaagttaatacaccattacagcattggggaaaacttactttcactttcct |
7274 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0079; HSP #2
Raw Score: 47; E-Value: 7e-18
Query Start/End: Original strand, 219 - 265
Target Start/End: Original strand, 7270 - 7316
Alignment:
| Q |
219 |
ttcctgataagtacaatcatcatatatacgctttgaactctctgctc |
265 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7270 |
ttcctgataagtacaatcatcatatatacgctttgaactctctgctc |
7316 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University