View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9771_low_47 (Length: 268)
Name: NF9771_low_47
Description: NF9771
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9771_low_47 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 233; Significance: 1e-129; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 233; E-Value: 1e-129
Query Start/End: Original strand, 7 - 255
Target Start/End: Complemental strand, 16683800 - 16683552
Alignment:
| Q |
7 |
tgcatgcccctttgaagttgttcttttggaccttcacttgcctgatttagatggatttgaagttaccgcaaggatccggaagtccaaaagccgtaactgg |
106 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
16683800 |
tgcatgcccctttgaagttgttattttggaccttcacttgcctgatttagatggatttgaagttactgcaaggatccggaagtccaaaagccgtaactgg |
16683701 |
T |
 |
| Q |
107 |
cctatcgttgttgctttatcggcaagctcagaagaagaattaagggaaaaatgtatgcatattgggtttaatggagttatccgaaagccgattctgttgc |
206 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16683700 |
cctatcgctgttgctttatcggcaagctcagaagaagaattaagggaaaaatgtatgcatattgggtttaatggagttatccgaaagccgattctgttgc |
16683601 |
T |
 |
| Q |
207 |
aaggattcacggaagaactccaaaaaatcctgaagggaaaataggtcct |
255 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16683600 |
aaggattcgcggaagaactccaaaaaatcctgaagggaaaataggtcct |
16683552 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University