View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9771_low_48 (Length: 266)
Name: NF9771_low_48
Description: NF9771
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9771_low_48 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 248; Significance: 1e-138; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 248; E-Value: 1e-138
Query Start/End: Original strand, 1 - 248
Target Start/End: Original strand, 8016627 - 8016874
Alignment:
| Q |
1 |
tttattagtgtatgacatacgacatacatacccggagggaagagtgtggacataagttggtatcatgggaagcccgggcccatcaacggaggaaagccca |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8016627 |
tttattagtgtatgacatacgacatacatacccggagggaagagtgtggacataagttggtatcatgggaagcccgggcccatcaacggaggaaagccca |
8016726 |
T |
|
| Q |
101 |
gcccgcatttcagaagacattgcatcagcaacatggtgaagaagaggtagaggagttgcacagtcttgtttgagtttcgttaataatctcgttggtccaa |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8016727 |
gcccgcatttcagaagacattgcatcagcaacatggtgaagaagaggtagaggagttgcacagtcttgtttgagtttcgttaataatctcgttggtccaa |
8016826 |
T |
|
| Q |
201 |
ctgaaaccttgttggatcggacggctgttgttgatcgccgatgggatc |
248 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8016827 |
ctgaaaccttgttggatcggacggctgttgttgatcgccgatgggatc |
8016874 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University