View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9771_low_54 (Length: 256)
Name: NF9771_low_54
Description: NF9771
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9771_low_54 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 239; Significance: 1e-132; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 239; E-Value: 1e-132
Query Start/End: Original strand, 1 - 246
Target Start/End: Complemental strand, 49876416 - 49876170
Alignment:
| Q |
1 |
ttatgtagttagcgataactaacataataaactatatatggtg-aagaatattagtttccacgtaaggaaatgtgttggttaatgataacttataacttc |
99 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49876416 |
ttatgtagttagcgataactaacataataaactatatatggtggaagaatattagtttccacgtaaggaaatgtgttggttaatgataacttataacttc |
49876317 |
T |
|
| Q |
100 |
cttgttggcaagttgttggattatgtatttagtttgtataaatcaacatacatggatgtggatatgaatgatgacggaagtcccaaacattattagatta |
199 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49876316 |
cttgttggcaagttgttggattatgtatttagtttgtataaatcaacatacatggatgtggatatgaatgatgacggaagtcccaaacattattagatta |
49876217 |
T |
|
| Q |
200 |
gtagagattttcatttgttcaaattttgaactttccttctgtgctcc |
246 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49876216 |
gtagagattttcatttgttcaaattttgaactttccttctgtgctcc |
49876170 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University