View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9771_low_61 (Length: 250)
Name: NF9771_low_61
Description: NF9771
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9771_low_61 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 239; Significance: 1e-132; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 239; E-Value: 1e-132
Query Start/End: Original strand, 1 - 243
Target Start/End: Complemental strand, 35174947 - 35174705
Alignment:
| Q |
1 |
ctaccatgtgtgcagagtaccagcgagtaagagtagttattgatgatgatgcagaggcggaaacagctccggcgatggtgaatgcgtggaggagaatgaa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35174947 |
ctaccatgtgtgcagagtaccagcgagtaagagtagttattgatgatgatgcagaggcggaaacagctccggcgatggtgaatgcgtggaggagaatgaa |
35174848 |
T |
|
| Q |
101 |
gaagatgccgcagattgaagggaaaaggttaagggagagagtgaggaagatgcaacttgaggatgcagataagagtatgtagttgcagaacaagaatgct |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35174847 |
gaagatgccgcagattgaagggaaaaggttaagggagagagtgaggaagatgcaacttgaggatgcagataagagtatgtagttgcagaacaagaatgct |
35174748 |
T |
|
| Q |
201 |
ttgtgaatgttgtattggtgttgttgactcattttctctgctt |
243 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
35174747 |
ttgtgaatgttgtattggtgttgttgactcattttctatgctt |
35174705 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University