View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9771_low_75 (Length: 240)
Name: NF9771_low_75
Description: NF9771
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9771_low_75 |
 |  |
|
| [»] scaffold0219 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr8 (Bit Score: 161; Significance: 5e-86; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 161; E-Value: 5e-86
Query Start/End: Original strand, 1 - 225
Target Start/End: Original strand, 35175269 - 35175492
Alignment:
| Q |
1 |
aacaatagcactgatttaagtgcttattatttgttggatttagat-gtttgattattactcnnnnnnncaacccttttattcttgatgatgttgtatgtg |
99 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
35175269 |
aacaatagcactgatttaagtgcttattatttgttggatttagattgtttgattattactctttttttcaacccttttattcttgatgatgttgtatgtg |
35175368 |
T |
 |
| Q |
100 |
ttgtgattatcatcccaacctttgttcaaaaaattatatatatgttttaattaagtcgtgctgannnnnnncttccctaaattctatgtccaaaatttta |
199 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
35175369 |
ttgtgattatcatcccaacctttgttcaaaaaattatatatatgttttaattaag--gtgctgatttttttcttccctaaattctatgtccaaaatttta |
35175466 |
T |
 |
| Q |
200 |
tgttcgctaatgattggaccttcaat |
225 |
Q |
| |
|
||||||||||||||| |||||||||| |
|
|
| T |
35175467 |
tgttcgctaatgattagaccttcaat |
35175492 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0219 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: scaffold0219
Description:
Target: scaffold0219; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 171 - 205
Target Start/End: Original strand, 7898 - 7932
Alignment:
| Q |
171 |
cttccctaaattctatgtccaaaattttatgttcg |
205 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||| |
|
|
| T |
7898 |
cttccctaaattccatgtccaaaattttatgttcg |
7932 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University