View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9771_low_85 (Length: 226)
Name: NF9771_low_85
Description: NF9771
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9771_low_85 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 137; Significance: 1e-71; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 137; E-Value: 1e-71
Query Start/End: Original strand, 18 - 211
Target Start/End: Complemental strand, 1424422 - 1424229
Alignment:
| Q |
18 |
cagcccaacaccaagcagcatgataacttccatgaacaaataccaaaggtggtgaacactgactttcactttcannnnnnnnnnnnnnnnnnngaacaat |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
1424422 |
cagcccaacaccaagcagcatgataacttccatgaacaaataccaaaggtggtgaacactgactttcactttcattcttcttcttcttcttctgaacaat |
1424323 |
T |
 |
| Q |
118 |
gacttccatgttcaaaccagaaggaagctcatggaaaatacgagattgcccttcctttagattgtaaggaacactcatcttctccttcttctgt |
211 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1424322 |
gacttccatgttcaaaccagaaggaagctcatggaaaatacgagattgcccttcctttagattgtaaggaacactcatcttctccttcttctgt |
1424229 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University