View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9771_low_86 (Length: 221)
Name: NF9771_low_86
Description: NF9771
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9771_low_86 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 166; Significance: 5e-89; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 166; E-Value: 5e-89
Query Start/End: Original strand, 18 - 202
Target Start/End: Complemental strand, 33735111 - 33734926
Alignment:
| Q |
18 |
agacccccgatccttgtcgaaaacaatattatttgaaataccatgcaacttcaccagaatgtgcatgaaggtttcaacatccttagagctcgtgtactat |
117 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
33735111 |
agacccccgatccttatcgaaaacaatattatttgaaataccatgcaacttcaccagaatgtgtatgaaggtttcaacatccttagagctcgtgtactat |
33735012 |
T |
|
| Q |
118 |
gattttaatgcagcgatgtgagtgtacttagaaatg-gatcaattaccaccaaaatgatggtgtaaccttgtgatgaagtccatcg |
202 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33735011 |
gattttaatgcagcgatgcgagtgtacttagaaatgcgatcaattaccaccaaaatgatggtgtaaccttgtgatgaagtccatcg |
33734926 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University