View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9772_high_21 (Length: 395)
Name: NF9772_high_21
Description: NF9772
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9772_high_21 |
 |  |
|
| [»] chr5 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 138; Significance: 5e-72; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 138; E-Value: 5e-72
Query Start/End: Original strand, 226 - 395
Target Start/End: Original strand, 39468012 - 39468181
Alignment:
| Q |
226 |
ttagaaaaatcggctcaaatcgttcataactggaaaacctagtgaactggacgtgtttatcgaagtcgagaggtctttgaattatgctagttctaaaaat |
325 |
Q |
| |
|
||||| ||| ||||||||| |||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
39468012 |
ttagagaaaccggctcaaaccgttcataactggaaaacgtagtgaactggacgtgtttatcgaagtcgagaggtcttggaattatgctagttctaaaaat |
39468111 |
T |
 |
| Q |
326 |
aacactgcaagaagttgatgaagaaacagattgaagaggatgatgaagcagaatcaaagggattagacaa |
395 |
Q |
| |
|
|| ||| ||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39468112 |
aagactacaagaagttgatgaagaaatagattgaagaggatgatgaagcagaatcaaagggattagacaa |
39468181 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 150 - 192
Target Start/End: Original strand, 39467972 - 39468014
Alignment:
| Q |
150 |
ctctcgccaatgtaccctattttcttatctctttattggatta |
192 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39467972 |
ctctcgccaatgtaccctattttcttatctctttattggatta |
39468014 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University