View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9772_high_28 (Length: 354)
Name: NF9772_high_28
Description: NF9772
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9772_high_28 |
 | |
|
| [»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 318; Significance: 1e-179; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 318; E-Value: 1e-179
Query Start/End: Original strand, 1 - 354
Target Start/End: Complemental strand, 53667102 - 53666749
Alignment:
| Q |
1 |
gatgaataagagcatcgatatctgaaacaatgcaaacgataatcataaaactggtatgtttatgtaaatgcaaggttttctaaattttcagattacgtaa |
100 |
Q |
| |
|
|||||||||||||||| |||||||||||| ||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
53667102 |
gatgaataagagcatccatatctgaaacagtgcaaacgataatcataaaaccggtatgtttatgtaaatgcaaggttttctaaattttcagattacataa |
53667003 |
T |
|
| Q |
101 |
tttgagcggtatcagtataagtttggtgatatgattgaaacgaaaatgcttaaaaattgaatgaggatggtttgagtcacattatctttgcttagacaaa |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
53667002 |
tttgagcggtatcagtataagtttggtgatatgattgaaacgaaaatgtttaaaaattgaatgaggaaggtttgagtcacattatctttgcttagacaaa |
53666903 |
T |
|
| Q |
201 |
aattgtgtgaatggagtctactgatgcttggattgtgacaatatgaatcatgtttcgacatatgatggtgtttttgggaggggtttggagtggaaggtga |
300 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
53666902 |
aattgtgtgaatggagtctactgatgcttggattgtgacaatatgaatcatgtttcgacatatgatggtgtttttgggaggggtttggattggaaggtga |
53666803 |
T |
|
| Q |
301 |
gaaatgtggtgaggtgatgcctaattttggacaatatataaataggtgtatttc |
354 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
53666802 |
gaaatgcggtgaggtgatgcctaattttggacaacatataaataggtgtatttc |
53666749 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University