View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9772_high_43 (Length: 271)
Name: NF9772_high_43
Description: NF9772
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9772_high_43 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 223; Significance: 1e-123; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 223; E-Value: 1e-123
Query Start/End: Original strand, 18 - 264
Target Start/End: Original strand, 29077463 - 29077709
Alignment:
| Q |
18 |
tatataactacaatttaagtcatttttacggataaaaaattagttgttttaaattttggtcataataatcatgtcatgccttaagatctcaacaaatgta |
117 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||| |||| |||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
29077463 |
tatataactacaatttaagtcatttttaaggataaaaggttagctgttttaaattttggtcataataatcatgtcatgccttaagaactcaacaaatgta |
29077562 |
T |
 |
| Q |
118 |
cttatcctaatgctctaactctagacctcactcaaatagcaacatgtggttgaaaggaattgcaaccaaatttaaactaatgatgatgatatctttaggc |
217 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
29077563 |
cttatcctaatgctctaactctagacctcactcaaatagcaacatgtggttgaaaggaattgcaaccaaatttaaactaatgatgataatatctttaggc |
29077662 |
T |
 |
| Q |
218 |
ctcactgtattaatggttcacctagctagtacgtagtacctatgctt |
264 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29077663 |
ctcactgtattaatggttcacctagctagtacgtagtacctatgctt |
29077709 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 81 - 124
Target Start/End: Complemental strand, 29076336 - 29076293
Alignment:
| Q |
81 |
aataatcatgtcatgccttaagatctcaacaaatgtacttatcc |
124 |
Q |
| |
|
||||| ||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
29076336 |
aataaccatgtcatgccttaagaactcaacaaatgtacttatcc |
29076293 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University