View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9772_high_45 (Length: 256)
Name: NF9772_high_45
Description: NF9772
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9772_high_45 |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 233; Significance: 1e-129; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 233; E-Value: 1e-129
Query Start/End: Original strand, 16 - 256
Target Start/End: Original strand, 17517792 - 17518032
Alignment:
| Q |
16 |
catttgtaatcttaaaacactgcaggtgtatatgttttacactagcactatacttttgatgaacaaagttctttgattttgattgaagaatgagtgcatc |
115 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17517792 |
catttgtaatcttaaaacactgcaggtgtatatgttttacactagcactgtacttttgatgaacaaagttctttgattttgattgaagaatgagtgcatc |
17517891 |
T |
 |
| Q |
116 |
tgagggatcagctgagggagcagcagaagtacatattgttcatgttagtgataggcagaatgttcctctggaagaagtaacatcttcattggagttaaac |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
17517892 |
tgagggatcagctgagggagcagcagaagtacatattgttcatgttagtgataggcagaatgttcctctggaagaagtaacatcttcattggagttaagc |
17517991 |
T |
 |
| Q |
216 |
aaggttgattatacaaaagagagaacgaaatcacttcatgc |
256 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17517992 |
aaggttgattatacaaaagagagaacgaaatcacttcatgc |
17518032 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University