View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9772_high_54 (Length: 248)
Name: NF9772_high_54
Description: NF9772
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9772_high_54 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 186; Significance: 1e-101; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 186; E-Value: 1e-101
Query Start/End: Original strand, 1 - 229
Target Start/End: Original strand, 6923994 - 6924235
Alignment:
| Q |
1 |
ttggaaatgcgcgtgagtgaaccatgtcccaccagctgttccttttcacgcctcc-------------gcgacccttccgatcgtaaccttatagtcgac |
87 |
Q |
| |
|
||||||||||||| || |||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
6923994 |
ttggaaatgcgcgcgattgaaccatgtcccaccagctgttccttttcacgcctccacgactgaaaacggcgacccttccgatcgtaaccttatagtcgac |
6924093 |
T |
 |
| Q |
88 |
ggtcatcatcttccactgtcactctacctggccttgaatattgtaacactgccttcccatcatgcgatagaacctgacgacaaaacccttgttcctcctt |
187 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6924094 |
ggtcatcatcttccactgtcactctacctggccttgaatattgtaacactaccttcccatcatgcgatagaacctgacgacaaaacccttgttcctcctt |
6924193 |
T |
 |
| Q |
188 |
gccgctgttcctcccgaaacctgtcccgtcgtccatccacct |
229 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6924194 |
gccgctgttcctcccgaaacctgtcccgtcgtccatccacct |
6924235 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University