View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF9772_high_57 (Length: 243)

Name: NF9772_high_57
Description: NF9772
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF9772_high_57
NF9772_high_57
[»] chr3 (2 HSPs)
chr3 (84-224)||(44989747-44989871)
chr3 (11-43)||(44989717-44989749)


Alignment Details
Target: chr3 (Bit Score: 71; Significance: 3e-32; HSPs: 2)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 71; E-Value: 3e-32
Query Start/End: Original strand, 84 - 224
Target Start/End: Original strand, 44989747 - 44989871
Alignment:
84 tttgctattcggtgagattgctctaggactttgtgtctttagggagtctcagttgggctcggctaggttttattttgatctggtatgcaactctgtctgt 183  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||               |||||  |||||||||||||||| ||||| |    
44989747 tttgctattcggtgagattgctctaggactttgtgtctttagggagtctcagtta--------------ttatt--gatctggtatgcaactatgtctct 44989830  T
184 ggtctatccaagaaacctcattatatgtctgtcattctctt 224  Q
    |||||||||||||||||||||||||||||||||||||||||    
44989831 ggtctatccaagaaacctcattatatgtctgtcattctctt 44989871  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 11 - 43
Target Start/End: Original strand, 44989717 - 44989749
Alignment:
11 atatcttataaattaagtcagtcatattgtttt 43  Q
    |||||||||||||||||||||||||||||||||    
44989717 atatcttataaattaagtcagtcatattgtttt 44989749  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University