View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9772_low_20 (Length: 411)
Name: NF9772_low_20
Description: NF9772
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9772_low_20 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 163; Significance: 6e-87; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 163; E-Value: 6e-87
Query Start/End: Original strand, 51 - 217
Target Start/End: Complemental strand, 22186997 - 22186831
Alignment:
| Q |
51 |
ggtgcaaagtttcttgttcttatgttcttcttttgttcaacatgtcttgtttctgaaatcattgtcttgttattttgttacatttatataaagttcatgt |
150 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22186997 |
ggtgcaaagtttcttgttcttatgttcttcttttgttcaacatgtcttgtttctgaaatcattgtcttgttattttgttacatttatataaagttcatgt |
22186898 |
T |
|
| Q |
151 |
gaacttattttcttggaagctaaactcttttcagcttgaagctcatgtgttagtagtataaatatgc |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
22186897 |
gaacttattttcttggaagctaaactcttttcagcttgaagctcatgtgttagtagtatatatatgc |
22186831 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 54; E-Value: 7e-22
Query Start/End: Original strand, 300 - 406
Target Start/End: Complemental strand, 22186748 - 22186648
Alignment:
| Q |
300 |
ctgaatttagatatgttaattgattttgaacacatgtannnnnnnnnnnnnnnnaaattaccataatcaaagtattaaaattcaaccattatatctttgt |
399 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22186748 |
ctgaatttagatatgttaattgattttgaacacatgtattttttttta------aaattaccataatcaaagtattaaaattcaaccattatatctttgt |
22186655 |
T |
|
| Q |
400 |
gtctgtg |
406 |
Q |
| |
|
||||||| |
|
|
| T |
22186654 |
gtctgtg |
22186648 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University