View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9772_low_31 (Length: 365)
Name: NF9772_low_31
Description: NF9772
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9772_low_31 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 246; Significance: 1e-136; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 246; E-Value: 1e-136
Query Start/End: Original strand, 25 - 294
Target Start/End: Complemental strand, 34004472 - 34004204
Alignment:
| Q |
25 |
cagaacaccttccttaaaactaacaagttttgagcaatgaatcacagacacttctcatattaagtgtgtttcagtgtcaggcacgcgtcatcttccgata |
124 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |||| |
|
|
| T |
34004472 |
cagaacaccttccttaaaactaacaagttttgagcaatgaatcacagacacttctcatattaagcgtgtttcagtgtcaggcacgcgtcatcttctgata |
34004373 |
T |
|
| Q |
125 |
tatatgaagtgtcattttttcaaatgactgttggtattttgtcgtgtctagtgtctgaatttgtttttgatagattttgagagacaaggagaaacatgaa |
224 |
Q |
| |
|
||||||||||||||||||||||| ||||||| |||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34004372 |
tatatgaagtgtcattttttcaa-tgactgtcggtattttgttgtgtctagtgtctgaatttgtttttgatagattttgagagacaaggagaaacatgaa |
34004274 |
T |
|
| Q |
225 |
cataattacatagttttcaggtaacacaagacaagacaagcaagttcaacgtggttattattatattatt |
294 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34004273 |
cataattacatagttttcaggtaacacaagacaagacaagcaagttcaacgtggttattattatattatt |
34004204 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 310 - 347
Target Start/End: Complemental strand, 34004160 - 34004123
Alignment:
| Q |
310 |
gaagtactcacgagaataccattggcgaacctaataag |
347 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34004160 |
gaagtactcacgagaataccattggcgaacctaataag |
34004123 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University