View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9772_low_32 (Length: 362)
Name: NF9772_low_32
Description: NF9772
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9772_low_32 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 148; Significance: 5e-78; HSPs: 3)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 148; E-Value: 5e-78
Query Start/End: Original strand, 69 - 236
Target Start/End: Complemental strand, 32639748 - 32639581
Alignment:
| Q |
69 |
acatgtatattttaaaaaccgaaccaaaccaatatgttcaatcgaacgaaccaaaaccgttcaatttgacattcccaattgtattgtagtcagattgaat |
168 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| ||||||| ||| ||||||||||||||||||||| |
|
|
| T |
32639748 |
acatgtatattttaaaaaccgaaccaaaccaatatgttcaatcaaacgaaccaaaaccgttcaattcgacattctcaactgtattgtagtcagattgaat |
32639649 |
T |
|
| Q |
169 |
ctggtttaaaccaagattaaattaggttaagctagttgaaccatgattgaatccaagttggtttaagc |
236 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32639648 |
ctggtttaaaccaagattaaattaggttaaactagttgaaccatgattgaatccaagttggtttaagc |
32639581 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 306 - 346
Target Start/End: Complemental strand, 32639511 - 32639471
Alignment:
| Q |
306 |
agttaaaccagttgattcaattaaaccatgactcagatgtc |
346 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32639511 |
agttaaaccagttgattcaattaaaccatgactcagatgtc |
32639471 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 23 - 65
Target Start/End: Complemental strand, 32639873 - 32639831
Alignment:
| Q |
23 |
tccctaagtatcgttttctaagtggattggagtagtacctttt |
65 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
32639873 |
tccctaagtatcgttttctaattggattggagtagtacctttt |
32639831 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University