View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9772_low_39 (Length: 338)
Name: NF9772_low_39
Description: NF9772
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9772_low_39 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 297; Significance: 1e-167; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 297; E-Value: 1e-167
Query Start/End: Original strand, 19 - 331
Target Start/End: Original strand, 35043534 - 35043846
Alignment:
| Q |
19 |
ataacgtgacactatgttttgctgtttttagttgaaaagtttggaatcttcaaatgcatagtgtaatgtttcatatgaaatttctttctactggtctaaa |
118 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
35043534 |
ataacgtgacactatgttttgctgttattagttgaaaagtttggaatcttcaaatgcatagtgtaatgtttcatatgaaatttctttctactgctctaaa |
35043633 |
T |
 |
| Q |
119 |
tattttgtatgtcggtatataattctatcatcttttatgcatgcttcaattatttttcaaaattattgggctggcccctgcatatgtgttttctctgccg |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
35043634 |
tattttgtatgtcggtatataattctatcatcttttgtgcatgcttcaattatttttcaaaattattgggctggcccctgcatatgtgttttctctgctg |
35043733 |
T |
 |
| Q |
219 |
gcagatagtgctcctccatcccttttatatacgttcaaatctacacctgcagagaaaccaacatcacacattacactacaccgctagctatagtactcca |
318 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35043734 |
gcagatagtgctcctccatcccttttatatacgttcaaatctacacctgcagagaaaccaacatcacacattacactacaccgctagctatagtactcca |
35043833 |
T |
 |
| Q |
319 |
tttctaacaccaa |
331 |
Q |
| |
|
||||||||||||| |
|
|
| T |
35043834 |
tttctaacaccaa |
35043846 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University