View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9772_low_43 (Length: 313)
Name: NF9772_low_43
Description: NF9772
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9772_low_43 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 272; Significance: 1e-152; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 272; E-Value: 1e-152
Query Start/End: Original strand, 11 - 298
Target Start/End: Original strand, 17075540 - 17075827
Alignment:
| Q |
11 |
cacagaataaatatcaccatggttaaccagcttgtttgcaagcagatgacagatatcagtgaggtggctgcaaacaacaggagatggagaagggatagaa |
110 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17075540 |
cacagaataaatatcaccatggttaaccagcttgtttgcaagcagatgacagatatcagtgaggtggctgcaaacaacaggagatggagaagggatagaa |
17075639 |
T |
|
| Q |
111 |
gagctgagacccgtttctgcattgacatcagtctgaactaaggtgttgtatatttcagagttacttgctggaagtcgacttgccaaagcaacaattgcct |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| || |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17075640 |
gagctgagacccgtttctgcattgacatcagtctgaactatggagttgtatatttcagagttacttgctggaagtcgacttgccaaagcaacaattgcct |
17075739 |
T |
|
| Q |
211 |
ggtctgacaacacatactttaagctctcgtcatgaatacgagcctgaaaggatgagcatgtaaaagaataatcagctcatgaaaataa |
298 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| ||||||||| |
|
|
| T |
17075740 |
ggtctgacaacacatactttaagctctcgtcatgaatacgagcctgaaaggatgagcatgcaaaagaataatcagctcgtgaaaataa |
17075827 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University