View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9772_low_45 (Length: 295)
Name: NF9772_low_45
Description: NF9772
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9772_low_45 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 264; Significance: 1e-147; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 264; E-Value: 1e-147
Query Start/End: Original strand, 22 - 293
Target Start/End: Complemental strand, 46504352 - 46504081
Alignment:
| Q |
22 |
ataagactattttataagaaacatataataaggattaagttgtaattatcatgtgatgattgtgatctttagtaccttgagatccaccaagcatttgaag |
121 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46504352 |
ataagactattttataagaaacatataataaggattaagttgtaattatcatgtgatgattgtgatctttagtaccttgagatccaccaagcatttgaag |
46504253 |
T |
 |
| Q |
122 |
agcattaacaaatctacggtgcaagtctggtgaccaacaccttcttgctttcctatgagtttggtttgaattattgcttgttgtctgagtttgtgatgat |
221 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46504252 |
agcattaacaaatctacggtgcaagtctggtgaccaacaccttcttgctttcctatgagtttggtttgaattattgcttgttgtctgagtttgtgatgat |
46504153 |
T |
 |
| Q |
222 |
gctactggacttccttttccttgattatcagcttcattccctgaatttgttttccctttctctgcttctcca |
293 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
46504152 |
gctactggacttccttttccttgattatcaacttcattccctgaatttgttttccctttttctgcttctcca |
46504081 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University