View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9772_low_60 (Length: 250)
Name: NF9772_low_60
Description: NF9772
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9772_low_60 |
 |  |
|
| [»] chr5 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 231; Significance: 1e-127; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 231; E-Value: 1e-127
Query Start/End: Original strand, 12 - 250
Target Start/End: Original strand, 2624316 - 2624554
Alignment:
| Q |
12 |
agagaacaagatttcggtattgaataattaattaactaattcaaaagtttttctacctagtttagttttctgtcttgtatattggtatgttctcaaattt |
111 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
2624316 |
agagaacaagatttcggtattgaataattaattaactaattcaaaagtttttctacctaatttagttttctgtcttgtatattgatatgttctcaaattt |
2624415 |
T |
 |
| Q |
112 |
atttattgtttctttgtgatttatgttatgtaagggaattttcaaaatagagagttgatgaaagttgaaaaagcgcaacgccatctttatggtcgtttct |
211 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2624416 |
atttattgtttctttgtgatttatgttatgtaagggaattttcaaaatagagagttgatgaaagttgaaaaagcgcaacgccatctttatggtcgtttct |
2624515 |
T |
 |
| Q |
212 |
tttaccgatttccaaatggtgaatctgcggctgatgtat |
250 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2624516 |
tttaccgatttccaaatggtgaatctgcggctgatgtat |
2624554 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University