View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9772_low_70 (Length: 238)
Name: NF9772_low_70
Description: NF9772
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9772_low_70 |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 192; Significance: 1e-104; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 192; E-Value: 1e-104
Query Start/End: Original strand, 14 - 238
Target Start/End: Complemental strand, 47297480 - 47297260
Alignment:
| Q |
14 |
caaaactttccacccttgatgtgttggcgaaaagcattgcgtttaaatcctgctgtagttttggcgacaaccaggaagagtcaaggaaatgacaggaaag |
113 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47297480 |
caaaactttccacccttgttgtgttggcgaaaagcattgcgtttaaatcctgctgtagttttggcgacaaccaggaagagtcaaggaaatgacaggaaag |
47297381 |
T |
 |
| Q |
114 |
ggtgccaaactggaaacgaagaagaaactaccaattggctttgatttcttaaaactcagccattgatttttgtgtttaccatctgtcggtcggaaccatg |
213 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| ||||||||||||||||||||||||| |||||||||| |
|
|
| T |
47297380 |
ggtgccaaactggaaacgaagaagaaactaccaattggctttgatttcttaaagctcagacattgatttttgtgtttaccatctg----tcggaaccata |
47297285 |
T |
 |
| Q |
214 |
acttcaaatttggaccacactacgc |
238 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
47297284 |
acttcaaatttggaccacactacgc |
47297260 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University