View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9772_low_73 (Length: 234)
Name: NF9772_low_73
Description: NF9772
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9772_low_73 |
 |  |
|
| [»] scaffold0368 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr2 (Bit Score: 211; Significance: 1e-116; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 211; E-Value: 1e-116
Query Start/End: Original strand, 1 - 211
Target Start/End: Original strand, 7390106 - 7390316
Alignment:
| Q |
1 |
tctcacacattttctcccaaaaccatggctgcttcttctctctttctcctccaagcctcccttatgggtcacgatctccgatctctttcttccatctacc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7390106 |
tctcacacattttctcccaaaaccatggctgcttcttctctctttctcctccaagcctcccttatgggtcacgatctccgatctctttcttccatctacc |
7390205 |
T |
 |
| Q |
101 |
aaactctgatagctctctctccattatgaacacagattgccgccgaaaaatttatttgtcgcactgatccacgcacatctcgccgactccgcaaatgccg |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7390206 |
aaactctgatagctctctctccattatgaacacagattgccgccgaaaaatttatttgtcgcactgatccacgcacatctcgccgactccgcaaatgccg |
7390305 |
T |
 |
| Q |
201 |
ccgcaacaaca |
211 |
Q |
| |
|
||||||||||| |
|
|
| T |
7390306 |
ccgcaacaaca |
7390316 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 199; E-Value: 1e-108
Query Start/End: Original strand, 1 - 211
Target Start/End: Complemental strand, 19587006 - 19586796
Alignment:
| Q |
1 |
tctcacacattttctcccaaaaccatggctgcttcttctctctttctcctccaagcctcccttatgggtcacgatctccgatctctttcttccatctacc |
100 |
Q |
| |
|
||||||||| ||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
19587006 |
tctcacacactttctcccaaaaccatgactgcttcttctctctttctcctccaagcctcccttatgggtcacgatctccgatctctttattccatctacc |
19586907 |
T |
 |
| Q |
101 |
aaactctgatagctctctctccattatgaacacagattgccgccgaaaaatttatttgtcgcactgatccacgcacatctcgccgactccgcaaatgccg |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19586906 |
aaactctgatagctctctctccattatgaacacagattgccgccgaaaaatttatttgtcgcactgatccacgcacatctcgccgactccgcaaatgccg |
19586807 |
T |
 |
| Q |
201 |
ccgcaacaaca |
211 |
Q |
| |
|
||||||||||| |
|
|
| T |
19586806 |
ccgcaacaaca |
19586796 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 195; Significance: 1e-106; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 195; E-Value: 1e-106
Query Start/End: Original strand, 1 - 211
Target Start/End: Complemental strand, 11658860 - 11658650
Alignment:
| Q |
1 |
tctcacacattttctcccaaaaccatggctgcttcttctctctttctcctccaagcctcccttatgggtcacgatctccgatctctttcttccatctacc |
100 |
Q |
| |
|
||||||||| |||||||||||||||||| |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11658860 |
tctcacacactttctcccaaaaccatggttgcttcttctctctttctccaccaagcctcccttatgggtcacgatctccgatctctttcttccatctacc |
11658761 |
T |
 |
| Q |
101 |
aaactctgatagctctctctccattatgaacacagattgccgccgaaaaatttatttgtcgcactgatccacgcacatctcgccgactccgcaaatgccg |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11658760 |
aaactctgatagctctctctccattatgaacacagatagccgccgaaaaatttatttgtcgcactgatccacgcacatctcgccgactccgcaaatgccg |
11658661 |
T |
 |
| Q |
201 |
ccgcaacaaca |
211 |
Q |
| |
|
||||||||||| |
|
|
| T |
11658660 |
ccgcaacaaca |
11658650 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 164; Significance: 9e-88; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 164; E-Value: 9e-88
Query Start/End: Original strand, 1 - 211
Target Start/End: Original strand, 51655243 - 51655454
Alignment:
| Q |
1 |
tctcacacattttctcccaaaaccatggctgcttcttctctctttctcctccaagcctcccttatgggtcacgatctccgatctctttcttccatctacc |
100 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |||||||||||||||||||||| |||||||||| |
|
|
| T |
51655243 |
tctcacacactttctcccaaaaccatggctgcttcttctctctttctccaccaagcctcccttatgagtcacgatctccgatctctttcctccatctacc |
51655342 |
T |
 |
| Q |
101 |
aaactctgatagctctctctccattatgaacacagattgc-cgccgaaaaatttatttgtcgcactgatccacgcacatctcgccgactccgcaaatgcc |
199 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||| ||||||||||||||||||| ||||||||||||||||||||||||||||||||| | || |
|
|
| T |
51655343 |
aaactctgatagctctctctccattatgaacaccgattgctggccgaaaaatttatttgtcacactgatccacgcacatctcgccgactccgcaatttcc |
51655442 |
T |
 |
| Q |
200 |
gccgcaacaaca |
211 |
Q |
| |
|
|||| ||||||| |
|
|
| T |
51655443 |
gccggaacaaca |
51655454 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 42; Significance: 0.000000000000005; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 15 - 87
Target Start/End: Original strand, 31447632 - 31447705
Alignment:
| Q |
15 |
tcccaaaaccatggctgcttcttctctctttctcctcc-aagcctcccttatgggtcacgatctccgatctctt |
87 |
Q |
| |
|
||||| || |||||||||||||||||||||||||| || |||||||||| | | |||||||||||||||||||| |
|
|
| T |
31447632 |
tcccagaatcatggctgcttcttctctctttctccaccaaagcctccctcacgagtcacgatctccgatctctt |
31447705 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 41; Significance: 0.00000000000002; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 24 - 121
Target Start/End: Complemental strand, 4328391 - 4328300
Alignment:
| Q |
24 |
catggctgcttcttctctctttctcctccaa-gcctcccttatgggtcacgatctccgatctctttcttccatctaccaaactctgatagctctctctc |
121 |
Q |
| |
|
|||||||||||||||||||||||||| |||| |||||||| || ||||||||||||||||||| ||||||||||||| | |||||||||||| |
|
|
| T |
4328391 |
catggctgcttcttctctctttctccaccaaagcctccctcttg-------atctccgatctctttcttcaatctaccaaactcggttagctctctctc |
4328300 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 164 - 211
Target Start/End: Complemental strand, 42837448 - 42837401
Alignment:
| Q |
164 |
ctgatccacgcacatctcgccgactccgcaaatgccgccgcaacaaca |
211 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||| |||||||| |
|
|
| T |
42837448 |
ctgatccacgcacatctcgccgactccgcaactgccgccacaacaaca |
42837401 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0368 (Bit Score: 40; Significance: 0.00000000000008; HSPs: 1)
Name: scaffold0368
Description:
Target: scaffold0368; HSP #1
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 164 - 211
Target Start/End: Original strand, 13359 - 13406
Alignment:
| Q |
164 |
ctgatccacgcacatctcgccgactccgcaaatgccgccgcaacaaca |
211 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||| |||||||| |
|
|
| T |
13359 |
ctgatccacgcacatctcgccgactccgcaactgccgccacaacaaca |
13406 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 30; Significance: 0.00000008; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 1 - 38
Target Start/End: Complemental strand, 24471124 - 24471087
Alignment:
| Q |
1 |
tctcacacattttctcccaaaaccatggctgcttcttc |
38 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
24471124 |
tctcacacacattctcccaaaaccatggctgcttcttc |
24471087 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University