View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9772_low_83 (Length: 203)
Name: NF9772_low_83
Description: NF9772
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9772_low_83 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 154; Significance: 7e-82; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 154; E-Value: 7e-82
Query Start/End: Original strand, 13 - 190
Target Start/End: Original strand, 15265908 - 15266085
Alignment:
| Q |
13 |
agcagagagatcttgtcgtatctgctgttgaacaaacgatgatttcaaccatgagtttgtcactctattgctaaatttttccttcctattaccactaaca |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |||||||||||||||||||||||||| |
|
|
| T |
15265908 |
agcagagagatcttgtcgtatctgctgttgaacaaacgatgatttcaaccatgagtttgtcactctgttgctgcatttttccttcctattaccactaaca |
15266007 |
T |
|
| Q |
113 |
ttaccttcaaaatgaattctttttcaagatgggaggatgatggccatggcattttccaaatcattattgtgatcattg |
190 |
Q |
| |
|
||||||||||||||| |||||||||||||||||| |||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
15266008 |
ttaccttcaaaatgatttctttttcaagatgggaagatgatggccatggcattttccaaatcattcttgtgatcattg |
15266085 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 71; E-Value: 2e-32
Query Start/End: Original strand, 26 - 143
Target Start/End: Original strand, 15276428 - 15276546
Alignment:
| Q |
26 |
tgtcgtatctgctgttgaacaaacgatgatttcaaccatgagtttgtcactctattgctaaatttttccttcct-attaccactaacattaccttcaaaa |
124 |
Q |
| |
|
||||| || |||||||| ||||||||| |||||||||||||| ||||||||||| |||| ||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
15276428 |
tgtcgaatttgctgttgtacaaacgattatttcaaccatgagcttgtcactctaatgctgcatttttccttcctaattaccactaacattaccttcaaaa |
15276527 |
T |
|
| Q |
125 |
tgaattctttttcaagatg |
143 |
Q |
| |
|
||| || |||||||||||| |
|
|
| T |
15276528 |
tgatttttttttcaagatg |
15276546 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University