View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9772_low_84 (Length: 202)
Name: NF9772_low_84
Description: NF9772
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9772_low_84 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 126; Significance: 3e-65; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 126; E-Value: 3e-65
Query Start/End: Original strand, 10 - 188
Target Start/End: Complemental strand, 44873192 - 44873014
Alignment:
| Q |
10 |
ggagcacagaagagattgctaatatgttgaaatcctgcacgtatctgctagactccaatatgtagaaatttagttaggtactannnnnnnnnnnnnnnca |
109 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| || |
|
|
| T |
44873192 |
ggagcacaaaagagattgctaatatgttgaaatcctgcacgtatctgctagactctaatatgtagaaatttagttaggtactattttttttttttttgca |
44873093 |
T |
 |
| Q |
110 |
tgatccgttatgtttttgggagaatatggcttaatttgcatttgtggtcgaagtgggttttatttttgttgtggtatgt |
188 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44873092 |
tgatccgttatgtttttgggagaatatggcttaatttgcatttgtggtcgaagtgggttttatttttgttgtggtatgt |
44873014 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University