View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9773_high_12 (Length: 249)
Name: NF9773_high_12
Description: NF9773
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9773_high_12 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 198; Significance: 1e-108; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 198; E-Value: 1e-108
Query Start/End: Original strand, 1 - 223
Target Start/End: Original strand, 33741782 - 33742004
Alignment:
| Q |
1 |
acaatggcaaaagagcatgnnnnnnncagtgaattcaaagcatctacttcaaaaaatctactgtgtcagtgtgagcacaaagatagcaaagtgtcctatt |
100 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33741782 |
acaatggcaaaagagcatgaaaaaaacagtgaattcaaagcatctacttcaaaaaatctaccgtgtcagtgtgagcacaaagatagcaaagtgtcctatt |
33741881 |
T |
|
| Q |
101 |
gtgttcttggactatgtgaaacatgctttaaacatgttagtagtttctttcttgtctagatgttagtagcttattttgcatatttcattttgcaaacaca |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33741882 |
gtgttcttggactatgtgaaacatgctttaaacatgttagtagtttctttcttgtctagatgttagtagcttattttgcatatttcattttgcaaacaca |
33741981 |
T |
|
| Q |
201 |
attttcaaatatctttttctcca |
223 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
33741982 |
attttcaaatatctttttctcca |
33742004 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 69 - 127
Target Start/End: Original strand, 33619529 - 33619587
Alignment:
| Q |
69 |
gtgtgagcacaaagatagcaaagtgtcctattgtgttcttggactatgtgaaacatgct |
127 |
Q |
| |
|
|||||| |||||||||||||||||| ||||| || ||||||||| |||||| |||||| |
|
|
| T |
33619529 |
gtgtgaacacaaagatagcaaagtgaactattttgatcttggactgtgtgaatcatgct |
33619587 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University