View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF9773_high_4 (Length: 412)

Name: NF9773_high_4
Description: NF9773
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF9773_high_4
NF9773_high_4
[»] chr3 (15 HSPs)
chr3 (19-367)||(16011415-16011763)
chr3 (298-406)||(9695607-9695715)
chr3 (192-406)||(9756397-9756611)
chr3 (325-406)||(9655375-9655456)
chr3 (325-406)||(9646382-9646463)
chr3 (307-410)||(41985641-41985744)
chr3 (299-384)||(9395298-9395383)
chr3 (299-410)||(9329849-9329960)
chr3 (299-410)||(9336553-9336664)
chr3 (301-410)||(9343858-9343967)
chr3 (301-410)||(9448327-9448436)
chr3 (325-382)||(9626498-9626555)
chr3 (310-410)||(9494811-9494911)
chr3 (307-395)||(13864232-13864320)
chr3 (307-410)||(41980867-41980970)
[»] chr6 (5 HSPs)
chr6 (325-410)||(7041509-7041594)
chr6 (299-386)||(9170854-9170941)
chr6 (299-386)||(7025793-7025880)
chr6 (299-386)||(7029850-7029937)
chr6 (299-386)||(9159487-9159574)
[»] chr2 (1 HSPs)
chr2 (301-410)||(20694295-20694404)
[»] chr1 (3 HSPs)
chr1 (330-386)||(8814385-8814441)
chr1 (299-386)||(231618-231705)
chr1 (366-410)||(4439873-4439917)
[»] chr5 (1 HSPs)
chr5 (300-369)||(18571165-18571234)


Alignment Details
Target: chr3 (Bit Score: 269; Significance: 1e-150; HSPs: 15)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 269; E-Value: 1e-150
Query Start/End: Original strand, 19 - 367
Target Start/End: Original strand, 16011415 - 16011763
Alignment:
19 gcgagtactctggtgagccgatgattttccatcgcggagatgatcactggacaaatatccccgatgtcccaaatgtggaaaagtcgcatggagatatttt 118  Q
    ||||||||||||||||||  || ||||||| | |||| |||||||| ||||||||||| ||||||||||||||||||||||| || |||||||||||||     
16011415 gcgagtactctggtgagctaattattttccgttgcggggatgatcattggacaaatatgcccgatgtcccaaatgtggaaaaatcacatggagatatttg 16011514  T
119 caattttaaagggaggccttgtgtaatagatcgaaccggtcagactgtgatgatcgaatcagacttgactgctcatttggtggctgaaccttgttttggt 218  Q
    ||||||||||||||||||||||||||||||| ||||||||| |||| |||||||||||||||||||||||| |||||||| |||||||||||||||||||    
16011515 caattttaaagggaggccttgtgtaatagatagaaccggtcggactatgatgatcgaatcagacttgactgttcatttggcggctgaaccttgttttggt 16011614  T
219 ggcgatactaaattcttggtagagagtaagtgtcagctgttgcttgtggatagatacgaaagtgatggtagtagtggtaatgtaaggattgatgtgtttg 318  Q
    |||||||||||||||||||||||||||||||||| | |||||| |||||||||||| |||||||||||||||||||||||||||||||||||||||||||    
16011615 ggcgatactaaattcttggtagagagtaagtgtcggttgttgcatgtggatagatatgaaagtgatggtagtagtggtaatgtaaggattgatgtgtttg 16011714  T
319 ggctcgatgagaaggagaagaattgggttaaattgcctaatttagggga 367  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||    
16011715 ggctcgatgagaaggagaagaattgggttaaattgcctaatttagggga 16011763  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 61; E-Value: 5e-26
Query Start/End: Original strand, 298 - 406
Target Start/End: Original strand, 9695607 - 9695715
Alignment:
298 atgtaaggattgatgtgtttgggctcgatgagaaggagaagaattgggttaaattgcctaatttaggggatagggttttgtttttgggggaaggttgttc 397  Q
    ||||||| |||||||| ||  |||| ||||||||||||||||| ||||| || ||| | ||||||||||||||||||||||||||||||||||  |||||    
9695607 atgtaagtattgatgtattcaggcttgatgagaaggagaagaagtgggtcaagttgaccaatttaggggatagggttttgtttttgggggaagactgttc 9695706  T
398 gttctctgc 406  Q
    |||||||||    
9695707 gttctctgc 9695715  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #3
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 192 - 406
Target Start/End: Complemental strand, 9756611 - 9756397
Alignment:
192 catttggtggctgaaccttgttttggtggcgatactaaattcttggtagagagtaagtgtcagctgttgcttgtggatagatacgaaagtgatggtagta 291  Q
    |||||||||||||| || |   ||||||||||   |||||||||||| |||||| | ||| || ||||||| |||||||||||   |||| |||||        
9756611 catttggtggctgagccgttcattggtggcgacgttaaattcttggtggagagtgaatgtgagttgttgctagtggatagatatttaagtaatggtgacg 9756512  T
292 gtggtaatgtaaggattgatgtgtttgggctcgatgagaaggagaagaattgggttaaattgcctaatttaggggatagggttttgtttttgggggaagg 391  Q
     || | |||||| ||||||||||| | |||| |||||||| ||||| |  ||||| || |||   ||||| |||||||||||||||||||| ||||||||    
9756511 atgatgatgtaaagattgatgtgtataggcttgatgagaaagagaaaaggtgggtcaagttggtgaatttgggggatagggttttgtttttcggggaagg 9756412  T
392 ttgttcgttctctgc 406  Q
     ||||| ||||||||    
9756411 ctgttcattctctgc 9756397  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #4
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 325 - 406
Target Start/End: Original strand, 9655375 - 9655456
Alignment:
325 atgagaaggagaagaattgggttaaattgcctaatttaggggatagggttttgtttttgggggaaggttgttcgttctctgc 406  Q
    |||||||||||||||| ||||| || |||   ||||||||||||||||||||||||||||| ||||| |||||||| |||||    
9655375 atgagaaggagaagaaatgggtgaagttgatgaatttaggggatagggttttgtttttgggcgaaggatgttcgttttctgc 9655456  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #5
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 325 - 406
Target Start/End: Original strand, 9646382 - 9646463
Alignment:
325 atgagaaggagaagaattgggttaaattgcctaatttaggggatagggttttgtttttgggggaaggttgttcgttctctgc 406  Q
    |||||||||||||||| ||||| || |||   |||||||||||||||||||||||||| || ||||| |||||||| |||||    
9646382 atgagaaggagaagaaatgggtgaagttgatgaatttaggggatagggttttgttttttggcgaaggatgttcgttttctgc 9646463  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #6
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 307 - 410
Target Start/End: Complemental strand, 41985744 - 41985641
Alignment:
307 ttgatgtgtttgggctcgatgagaaggagaagaattgggttaaattgcctaatttaggggatagggttttgtttttgggggaaggttgttcgttctctgc 406  Q
    ||||||||||  | || ||||||||||||||||| ||||| || ||| | | |||||||||||| |||||||| |||||| | || |||||||| |||||    
41985744 ttgatgtgttcagacttgatgagaaggagaagaaatgggtcaagttggcgagtttaggggatagagttttgttcttggggaatggatgttcgttttctgc 41985645  T
407 ttct 410  Q
    ||||    
41985644 ttct 41985641  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #7
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 299 - 384
Target Start/End: Complemental strand, 9395383 - 9395298
Alignment:
299 tgtaaggattgatgtgtttgggctcgatgagaaggagaagaattgggttaaattgcctaatttaggggatagggttttgtttttgg 384  Q
    ||||||||||||||||||| |||| ||||||||| |||| || ||||| || ||| |||||||||| |||  ||||||||| ||||    
9395383 tgtaaggattgatgtgtttaggcttgatgagaagcagaaaaagtgggtgaagttgactaatttaggagatttggttttgttcttgg 9395298  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #8
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 299 - 410
Target Start/End: Complemental strand, 9329960 - 9329849
Alignment:
299 tgtaaggattgatgtgtttgggctcgatgagaaggagaagaattgggttaaattgcctaatttaggggatagggttttgtttttgggggaaggttgttcg 398  Q
    |||| |||||||||||||| |||| |||||||| ||||| |  ||||| || ||| | |||||||| |||| ||||||||| |||||| | || | ||||    
9329960 tgtatggattgatgtgtttaggcttgatgagaaagagaaaaggtgggtcaagttggcgaatttaggagataaggttttgttcttggggaatggatattcg 9329861  T
399 ttctctgcttct 410  Q
    || |||||||||    
9329860 ttttctgcttct 9329849  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #9
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 299 - 410
Target Start/End: Complemental strand, 9336664 - 9336553
Alignment:
299 tgtaaggattgatgtgtttgggctcgatgagaaggagaagaattgggttaaattgcctaatttaggggatagggttttgtttttgggggaaggttgttcg 398  Q
    |||| |||||||||||||| |||| |||||||| ||||| |  ||||| ||  || | |||||||| |||| ||||||||| |||||| | || ||||||    
9336664 tgtatggattgatgtgtttaggcttgatgagaaagagaaaaggtgggtcaagctgacgaatttaggagataaggttttgttcttggggaatggatgttcg 9336565  T
399 ttctctgcttct 410  Q
    || |||||||||    
9336564 ttttctgcttct 9336553  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #10
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 301 - 410
Target Start/End: Complemental strand, 9343967 - 9343858
Alignment:
301 taaggattgatgtgtttgggctcgatgagaaggagaagaattgggttaaattgcctaatttaggggatagggttttgtttttgggggaaggttgttcgtt 400  Q
    ||||| |||||||||||  ||| ||||||| ||||||||| ||||| || ||  | | |||||||||||| |||||||| |||||| | |  ||||||||    
9343967 taagggttgatgtgtttaagcttgatgagatggagaagaagtgggtgaagttaacaactttaggggatagtgttttgttcttggggaatgaatgttcgtt 9343868  T
401 ctctgcttct 410  Q
     |||||||||    
9343867 ttctgcttct 9343858  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #11
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 301 - 410
Target Start/End: Complemental strand, 9448436 - 9448327
Alignment:
301 taaggattgatgtgtttgggctcgatgagaaggagaagaattgggttaaattgcctaatttaggggatagggttttgtttttgggggaaggttgttcgtt 400  Q
    ||||| |||||||||||  |||  |||||||||||||||| ||||| || ||  | | |||||||||||| |||||||| |||||| | |  ||||||||    
9448436 taagggttgatgtgtttaagctttatgagaaggagaagaaatgggtgaagttaacaactttaggggatagtgttttgttcttggggaatgactgttcgtt 9448337  T
401 ctctgcttct 410  Q
     |||||||||    
9448336 ttctgcttct 9448327  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #12
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 325 - 382
Target Start/End: Original strand, 9626498 - 9626555
Alignment:
325 atgagaaggagaagaattgggttaaattgcctaatttaggggatagggttttgttttt 382  Q
    |||||||||||||||| ||||| || |||   ||||||||||||||||||||||||||    
9626498 atgagaaggagaagaaatgggtgaatttgatgaatttaggggatagggttttgttttt 9626555  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #13
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 310 - 410
Target Start/End: Original strand, 9494811 - 9494911
Alignment:
310 atgtgtttgggctcgatgagaaggagaagaattgggttaaattgcctaatttaggggatagggttttgtttttgggggaaggttgttcgttctctgcttc 409  Q
    ||||| || |||| ||||||||||||| ||  ||||| || |||   | ||||||||||||||||||||| |||||| | || |||||||| ||||||||    
9494811 atgtgcttaggcttgatgagaaggagatgagatgggtgaatttgatgagtttaggggatagggttttgttcttggggaatggatgttcgttttctgcttc 9494910  T
410 t 410  Q
    |    
9494911 t 9494911  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #14
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 307 - 395
Target Start/End: Complemental strand, 13864320 - 13864232
Alignment:
307 ttgatgtgtttgggctcgatgagaaggagaagaattgggttaaattgcctaatttaggggatagggttttgtttttgggggaaggttgt 395  Q
    ||||||||||| |||| ||||||| |||||| || |||||  |  ||   ||||| |||||||||||||||||||||||||||| ||||    
13864320 ttgatgtgtttaggcttgatgagagggagaaaaagtgggtggaggtgagaaatttgggggatagggttttgtttttgggggaagattgt 13864232  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #15
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 307 - 410
Target Start/End: Complemental strand, 41980970 - 41980867
Alignment:
307 ttgatgtgtttgggctcgatgagaaggagaagaattgggttaaattgcctaatttaggggatagggttttgtttttgggggaaggttgttcgttctctgc 406  Q
    ||||||||||| |||| | | |||| |||||||| ||||| || ||| | | |||||||||||| |||||||| |||||| | || |||||||| | |||    
41980970 ttgatgtgtttaggcttgctaagaaagagaagaaatgggtcaagttgacgagtttaggggatagagttttgttcttggggaatggatgttcgttttttgc 41980871  T
407 ttct 410  Q
    ||||    
41980870 ttct 41980867  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6 (Bit Score: 46; Significance: 4e-17; HSPs: 5)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 325 - 410
Target Start/End: Complemental strand, 7041594 - 7041509
Alignment:
325 atgagaaggagaagaattgggttaaattgcctaatttaggggatagggttttgtttttgggggaaggttgttcgttctctgcttct 410  Q
    |||||||||||||||| ||||| || ||| ||| ||||||||||||||||||||| ||||| ||||  ||||||||||||| ||||    
7041594 atgagaaggagaagaagtgggtgaagttgactagtttaggggatagggttttgttcttgggagaagtatgttcgttctctgtttct 7041509  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #2
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 299 - 386
Target Start/End: Complemental strand, 9170941 - 9170854
Alignment:
299 tgtaaggattgatgtgtttgggctcgatgagaaggagaagaattgggttaaattgcctaatttaggggatagggttttgtttttgggg 386  Q
    ||||||||||||| |||||  |||  |||||||||||||||| ||||| |||||  | | ||||||||||||||||||||| ||||||    
9170941 tgtaaggattgatttgtttaagcttaatgagaaggagaagaagtgggtgaaattaacgagtttaggggatagggttttgttcttgggg 9170854  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #3
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 299 - 386
Target Start/End: Complemental strand, 7025880 - 7025793
Alignment:
299 tgtaaggattgatgtgtttgggctcgatgagaaggagaagaattgggttaaattgcctaatttaggggatagggttttgtttttgggg 386  Q
    ||||||||||||| |||||  |||  |||||||||||||||| ||||| || ||| | | |||||| |||||||||||||| ||||||    
7025880 tgtaaggattgatttgtttaagcttaatgagaaggagaagaagtgggtgaagttgacgagtttaggagatagggttttgttcttgggg 7025793  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #4
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 299 - 386
Target Start/End: Complemental strand, 7029937 - 7029850
Alignment:
299 tgtaaggattgatgtgtttgggctcgatgagaaggagaagaattgggttaaattgcctaatttaggggatagggttttgtttttgggg 386  Q
    ||||||||||||| |||||  |||  |||||||||||||||| ||||| || ||| | | ||| ||||||||||||||||| ||||||    
7029937 tgtaaggattgatttgtttaagcttaatgagaaggagaagaagtgggtgaagttgacgagtttcggggatagggttttgttcttgggg 7029850  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #5
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 299 - 386
Target Start/End: Original strand, 9159487 - 9159574
Alignment:
299 tgtaaggattgatgtgtttgggctcgatgagaaggagaagaattgggttaaattgcctaatttaggggatagggttttgtttttgggg 386  Q
    ||||||||||||| |||||  |||  | |||||||||||||| ||||| |||||  | | ||||||||||||||||||||| ||||||    
9159487 tgtaaggattgatttgtttaagcttaacgagaaggagaagaagtgggtgaaattaacgagtttaggggatagggttttgttcttgggg 9159574  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 38; Significance: 0.000000000002; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 301 - 410
Target Start/End: Original strand, 20694295 - 20694404
Alignment:
301 taaggattgatgtgtttgggctcgatgagaaggagaagaattgggttaaattgcctaatttaggggatagggttttgtttttgggggaaggttgttcgtt 400  Q
    |||| ||| |||||||  |||| ||||| ||||||||||| ||||| |  ||| | | ||| |||||||||||||||||||||||| | || ||||||||    
20694295 taagaatttatgtgttcaggcttgatgaaaaggagaagaaatgggtgagtttgacaagtttgggggatagggttttgtttttggggaatggatgttcgtt 20694394  T
401 ctctgcttct 410  Q
     |||||||||    
20694395 ttctgcttct 20694404  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 33; Significance: 0.000000002; HSPs: 3)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 330 - 386
Target Start/End: Original strand, 8814385 - 8814441
Alignment:
330 aaggagaagaattgggttaaattgcctaatttaggggatagggttttgtttttgggg 386  Q
    ||||||||||| ||||| || ||| | |||||||||||||| |||||||||||||||    
8814385 aaggagaagaagtgggtgaagttggcgaatttaggggatagagttttgtttttgggg 8814441  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 299 - 386
Target Start/End: Complemental strand, 231705 - 231618
Alignment:
299 tgtaaggattgatgtgtttgggctcgatgagaaggagaagaattgggttaaattgcctaatttaggggatagggttttgtttttgggg 386  Q
    ||||||||| |||||||||  |||| |||  ||||||| ||| ||||| || ||| |||||||||||||||  |||||||| ||||||    
231705 tgtaaggatagatgtgtttaagctcaatgcaaaggagatgaagtgggtgaagttggctaatttaggggatatagttttgttcttgggg 231618  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #3
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 366 - 410
Target Start/End: Complemental strand, 4439917 - 4439873
Alignment:
366 gatagggttttgtttttgggggaaggttgttcgttctctgcttct 410  Q
    ||||||||||||||||||||| | || |||||||| |||||||||    
4439917 gatagggttttgtttttggggaatggatgttcgttttctgcttct 4439873  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 300 - 369
Target Start/End: Complemental strand, 18571234 - 18571165
Alignment:
300 gtaaggattgatgtgtttgggctcgatgagaaggagaagaattgggttaaattgcctaatttaggggata 369  Q
    |||||||||||| | |||  ||| ||||||||||||||||| ||||| |||||| | | |||||||||||    
18571234 gtaaggattgatttctttaagcttgatgagaaggagaagaagtgggtgaaattgacgagtttaggggata 18571165  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University