View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9773_low_13 (Length: 286)
Name: NF9773_low_13
Description: NF9773
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9773_low_13 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 248; Significance: 1e-138; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 248; E-Value: 1e-138
Query Start/End: Original strand, 7 - 270
Target Start/End: Original strand, 48076573 - 48076836
Alignment:
| Q |
7 |
gagaagcaaaggcatgtggggaaaattaatgtgttatggggtctatctcttacacatttgtcttttttaacgtacgtcaataattgtgcaagtaatatta |
106 |
Q |
| |
|
|||||||| | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48076573 |
gagaagcatatgcatgtggggaaaattaatgtgttatggggtctatctcttacacatttgtcttttttaacgtacgtcaataattgtgcaagtaatatta |
48076672 |
T |
|
| Q |
107 |
aatgatgcacttactcaaatgcattgcagaggctttatgaattgggagcaagaagagttttggtgactggtacaggaccgttaggttgtgtcccagcaga |
206 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
48076673 |
aatgatgcacttactcaaatgcattgcagaggctttatgaattgggagcaagaagagttttggtgactggtacaggaccgttaggctgtgtcccagcaga |
48076772 |
T |
|
| Q |
207 |
attagctcagcatagcagaaatggcgaatgttatgcagaattgcaggaagctgccaacttgttc |
270 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
48076773 |
attagctcagcatagcagaaatggcgaatgttatgcagaattgcaggaagctgccaatttgttc |
48076836 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 48; Significance: 2e-18; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 142 - 209
Target Start/End: Complemental strand, 6340964 - 6340897
Alignment:
| Q |
142 |
tatgaattgggagcaagaagagttttggtgactggtacaggaccgttaggttgtgtcccagcagaatt |
209 |
Q |
| |
|
|||||||||||||||||||||||||||||||| || || ||||| ||||||||||| ||||||||||| |
|
|
| T |
6340964 |
tatgaattgggagcaagaagagttttggtgacaggaacgggaccattaggttgtgtaccagcagaatt |
6340897 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University