View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9773_low_16 (Length: 271)
Name: NF9773_low_16
Description: NF9773
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9773_low_16 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 208; Significance: 1e-114; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 208; E-Value: 1e-114
Query Start/End: Original strand, 1 - 258
Target Start/End: Original strand, 37314370 - 37314631
Alignment:
| Q |
1 |
tttgttgtaaagtcaaactatatcttatgctacacacatttgcacactattggatatcaccttttgtgcaatttttatgacactctatactttaatgacg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37314370 |
tttgttgtaaagtcaaactatatcttatgctacacacatttgcacactattggatatcaccttttgtgcaatttttatgacactctatactttaatgacg |
37314469 |
T |
|
| Q |
101 |
attgagtattaaacatacttaacaagttgaaattcttgt-nnnnnnnnccattggtaatagtaatacatcacacaggaacagtcctattagaagaggctt |
199 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37314470 |
attgagtattagacatacttaacaagttgaaattcttgtaaaaaaaaaccattggtaatagtaatacatcacacaggaacagtcctattagaagaggctt |
37314569 |
T |
|
| Q |
200 |
gtgtatcaacaacagcagcttcagt---ttcttcttcttcattctctccactcatttcttcc |
258 |
Q |
| |
|
||| ||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
37314570 |
gtggatcaacaacagcagcttcagtttcttcttcttcttcattctctccactcatttcttcc |
37314631 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University