View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9773_low_30 (Length: 241)
Name: NF9773_low_30
Description: NF9773
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9773_low_30 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 216; Significance: 1e-119; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 216; E-Value: 1e-119
Query Start/End: Original strand, 1 - 224
Target Start/End: Complemental strand, 11622222 - 11621999
Alignment:
| Q |
1 |
atcaggatctgcatcatttaaaaagaacataaacatctcaactgcataacaaccaccaatttcaaatcggcaatgcatgaataatttataaattggcttg |
100 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11622222 |
atcaggatctgcatcatttaaacagaacataaacatctcaactgcataacaaccaccgatttcaaatcggcaatgcatgaataatttataaattggcttg |
11622123 |
T |
|
| Q |
101 |
ttaaaatacaacaatcaacaaatgcattttcccccaatgcagtcaactatgtggatcaaacagcaatgccataacatattatagcaaatctaagaaatga |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11622122 |
ttaaaatacaacaatcaacaaatgcattttcccccaatgcagtcaactatgtggatcaaacagcaatgccataacatattatagcaaatctaagaaatga |
11622023 |
T |
|
| Q |
201 |
aaaatacaatatgaccctagagat |
224 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
11622022 |
aaaatacaatatgaccctagagat |
11621999 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University