View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9773_low_7 (Length: 398)
Name: NF9773_low_7
Description: NF9773
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9773_low_7 |
 |  |
|
| [»] chr7 (1 HSPs) |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 330; Significance: 0; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 330; E-Value: 0
Query Start/End: Original strand, 20 - 398
Target Start/End: Original strand, 449755 - 450125
Alignment:
| Q |
20 |
agtcagactacccgtactgactgtaagtttggtgttgccttgtgtcaggaggaacaaccttttgtaatcgtcacaactgagaaaaatcgaaagcctgtta |
119 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
449755 |
agtcagaatacccgtactgactgtaagtttggtgttgcctcgtgtcaggaggaacaaccttttgtaatcgtcacaactgagaaaaatcaaaagcctgtta |
449854 |
T |
 |
| Q |
120 |
tgttccgttgcggggacgaccatttgacgacgatccccaacatgccaaccccttgtaaagtcatgaactgtgcttttaaaggaaggccttgtgtggtaga |
219 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
449855 |
tgttccgttgcggggacgaccatttgacgacgatccccaacatgtcaaccccttgtaaagtcatgaactgtgcttttaaaggaaggccttgtgtggtaga |
449954 |
T |
 |
| Q |
220 |
cagtaccaatcggactgtgatgattggaccagacatgagcattcatttgatggctcaggctgacccgtggtatggtgggagaagaaaattcttggtggcg |
319 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
449955 |
cagtaccaatcagactgtgatgattggaccagacatgagcattcatttgatggctcaggctgacccgtggtatggtgggagaagaaaattcttggtggcg |
450054 |
T |
 |
| Q |
320 |
agtagtgagttccagttgttgctagtgatttgctatacaaacggtgaccgtgttactgtatggattgatgtgtttaggc |
398 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
450055 |
agtagtgagttccagttgttgctagtgatttgctatacaaacggtg--------actgtatggattgatgtgtttaggc |
450125 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 305 - 398
Target Start/End: Complemental strand, 9395454 - 9395361
Alignment:
| Q |
305 |
aaattcttggtggcgagtagtgagttccagttgttgctagtgatttgctatacaaacggtgaccgtgttactgtatggattgatgtgtttaggc |
398 |
Q |
| |
|
||||||||||| | || |||||| || ||||||||||||||| | |||| ||| | ||| ||||||| |||| |||||||||||||||||| |
|
|
| T |
9395454 |
aaattcttggtcgagactagtgactttcagttgttgctagtggatatatataaaaatgatgatcgtgttattgtaaggattgatgtgtttaggc |
9395361 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University