View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9773_low_9 (Length: 359)
Name: NF9773_low_9
Description: NF9773
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9773_low_9 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 144; Significance: 1e-75; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 144; E-Value: 1e-75
Query Start/End: Original strand, 6 - 199
Target Start/End: Original strand, 27612649 - 27612837
Alignment:
| Q |
6 |
agtgcgacctattttttaatgttttaaaaaataatctcataaaa-atgaagataattccaactctccccaatctttaataagaggcacaaacaaacccgc |
104 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
27612649 |
agtgcgacctattttttaatgttttaaaaaataatctcataaaaaatgaagataattccaactctccccaatctttaatatgaggcacaaacaaacccgc |
27612748 |
T |
|
| Q |
105 |
aaagtgaaaaattaattttgtacatgtacgcgggtgctggattgtacgatggtgtgaaagggactggctctaaatttggattgcaatctgattta |
199 |
Q |
| |
|
|||||||||||||||||| || ||| |||||||||||||||| |||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
27612749 |
aaagtgaaaaattaattt------tgcacgtgggtgctggattgtacaatggtgtgaaagggactggctctaaatttggactgcaatctgattta |
27612837 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 222 - 288
Target Start/End: Original strand, 27612860 - 27612926
Alignment:
| Q |
222 |
aagaaaaccttatggttgtattttatcaggaagatgatattttgtttgggagttttgaatacgaata |
288 |
Q |
| |
|
|||||||||||||||||||||| ||||||||| ||||||||| || ||||||||| | |||||||| |
|
|
| T |
27612860 |
aagaaaaccttatggttgtattctatcaggaaaatgatatttagtacgggagttttaagtacgaata |
27612926 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University