View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9774_low_6 (Length: 378)
Name: NF9774_low_6
Description: NF9774
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9774_low_6 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 300; Significance: 1e-168; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 300; E-Value: 1e-168
Query Start/End: Original strand, 17 - 371
Target Start/End: Original strand, 36275686 - 36276025
Alignment:
| Q |
17 |
gtttcttcttcaccgttttgttctacttcatcagtcttgtctgtgccttctattccgaatcttccaccggttaaaaccaaacttgataaccaagtttctg |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36275686 |
gtttcttcttcaccgttttgttctacttcatcagtcttgtctgtgccttctattccgaatcttccaccggttaaaaccaaacttgataaccaagtttctg |
36275785 |
T |
 |
| Q |
117 |
aaccggttttcaaaggaaatcaaattgaaactgaaacggttttgcaaccacaattgaaaatggataattatcagattaaccctgcaattcactaccaaca |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36275786 |
aaccggttttcaaaggaaatcaaattgaaactgaaacggttttgcaaccacaattgaaaatggataattatcagattaaccctgcaattcactaccaaca |
36275885 |
T |
 |
| Q |
217 |
acctcaaccacgaccacaaccacaaccacaagaaggtgcttattctggtcatcatgcacaaccggttccggtttattatattcagggttcggttcaaccc |
316 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36275886 |
acctcaaccacg------accacaaccacaagaaggtgcttattctggtcatcatgcacaaccggttccggtttattatattcagggttcggttcaaccc |
36275979 |
T |
 |
| Q |
317 |
gggaatgtaccggttcatccggttcatatgcaaggacatggacattatccctatg |
371 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36275980 |
gggaatgta---------ccggttcatatgcaaggacatggacattatccctatg |
36276025 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University