View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9774_low_7 (Length: 308)
Name: NF9774_low_7
Description: NF9774
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9774_low_7 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 177; Significance: 2e-95; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 177; E-Value: 2e-95
Query Start/End: Original strand, 97 - 298
Target Start/End: Complemental strand, 7965880 - 7965679
Alignment:
| Q |
97 |
ttaacattggaaacgttgggtagtaaaagggtaataaggaactgcaaagtttcccttcaaaactaagcaatggtaagtaactaggaaaataattgacaaa |
196 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
7965880 |
ttaacattggaaacgttgggtagtaaaagggtaataaggaactgcaaagtttcccttcaaaactaagcaatggtaagtaactaggaaaataattgagaaa |
7965781 |
T |
 |
| Q |
197 |
agttcatcagtacacactacaactgcagttgttctggtcaaaagctgaacctactttatatgnnnnnnngaatttctaaatgcaatggattaaaacccta |
296 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
7965780 |
agttcatcagtacacactacaactgcagttgttctggtcaaaagctgaacctactttatatgtttttttgaatttctaaatgcaatggattaaaacccta |
7965681 |
T |
 |
| Q |
297 |
tg |
298 |
Q |
| |
|
|| |
|
|
| T |
7965680 |
tg |
7965679 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University