View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9774_low_9 (Length: 305)
Name: NF9774_low_9
Description: NF9774
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9774_low_9 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 54; Significance: 5e-22; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 54; E-Value: 5e-22
Query Start/End: Original strand, 60 - 132
Target Start/End: Complemental strand, 36398846 - 36398771
Alignment:
| Q |
60 |
taaattgaaatttaaactaata---tatgcttaatagatttgaatacatttctctgaaattaagactcatcagtaa |
132 |
Q |
| |
|
|||||||||||||||||||||| ||| |||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
36398846 |
taaattgaaatttaaactaatacaatatacttaatagatttgaatacttttctctgaaattaagactcatcagtaa |
36398771 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 200 - 290
Target Start/End: Complemental strand, 36398614 - 36398527
Alignment:
| Q |
200 |
gacaacacctttttgacacataactgtaannnnnnngtttgtttgtttcccccaatcaatttgtcttattgaacaactcaaccaaatactt |
290 |
Q |
| |
|
||||||||||||||||||||||||||||| ||| |||| ||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
36398614 |
gacaacacctttttgacacataactgtaatttttttgttcgttt---tcccccaatcaatttgtcttattaaacaactcaaccaaatactt |
36398527 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University