View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9775_low_11 (Length: 295)
Name: NF9775_low_11
Description: NF9775
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9775_low_11 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 244; Significance: 1e-135; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 244; E-Value: 1e-135
Query Start/End: Original strand, 18 - 281
Target Start/End: Original strand, 45652955 - 45653218
Alignment:
| Q |
18 |
aatatgttgggatctaatagacaggacccatgctttttgatacatccctttcctgacacgtggccataaccatttattattgatattttaacgttttgtg |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
45652955 |
aatatgttgggatctaatagacaggacccatgctttttgatacatccctttcctgacacgtggccatatccatttattattgatattttaacgttttgtg |
45653054 |
T |
|
| Q |
118 |
tgcttgtcacaatctaattgagagagaggagatagacctaagcagagtgcccccatcaattcaatttcaaccataaagaacaactactgctagtgggtga |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| ||||||||||||||||||||||||| |||| || |
|
|
| T |
45653055 |
tgcttgtcacaatctaattgagagagaggagatagacctaagcagagtacccccatcaattcaattccaaccataaagaacaactactgctaatggggga |
45653154 |
T |
|
| Q |
218 |
aatgggttacccacttttgcttccttccattttgttgataaaagaaaatttgcacaactactcc |
281 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45653155 |
aatgggttacccacttttgcttccttccattttgttgataaaagaaaatttgcacaactactcc |
45653218 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University