View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9775_low_13 (Length: 250)
Name: NF9775_low_13
Description: NF9775
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9775_low_13 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 208; Significance: 1e-114; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 208; E-Value: 1e-114
Query Start/End: Original strand, 1 - 239
Target Start/End: Original strand, 9526679 - 9526915
Alignment:
| Q |
1 |
tttaagatgccgatctctcccaacatttttggttctttataaacctaagtatcgaacatttgaccacatacttaaaagattaaatgtcaataacatgtca |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |||||||||||||||||||||||||||| |||||| |
|
|
| T |
9526679 |
tttaagatgccgatctctcccaacatttttggttctttataaacttaagtatcgaacatttgactacatacttaaaagattaaatgtcaataatatgtca |
9526778 |
T |
 |
| Q |
101 |
ttggtaaatgatcaaatgttatcggtatactttttatatttgtacttctatgaggtatctaaacacagactaatcttcttatgagaatttgttgtgcata |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
9526779 |
ttggtaaatgatcaaatgttatcggtatactttttatatttgtacttctatgaggtatctaaacacagactaatctccttatgagaatttgttgtgcata |
9526878 |
T |
 |
| Q |
201 |
taaggtgtattctctctctttttaacctaatttcttcat |
239 |
Q |
| |
|
|||||||||| ||| ||||||||||||||||||||||| |
|
|
| T |
9526879 |
taaggtgtat--tctttctttttaacctaatttcttcat |
9526915 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University