View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9775_low_14 (Length: 236)
Name: NF9775_low_14
Description: NF9775
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9775_low_14 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 200; Significance: 1e-109; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 200; E-Value: 1e-109
Query Start/End: Original strand, 20 - 223
Target Start/End: Complemental strand, 33298824 - 33298621
Alignment:
| Q |
20 |
gagtccaattactgtgatcttcaaaatcaatgaaataggagataaaatgattaacactaaatcttaccattgctccatagaagaccaaatatattgagac |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33298824 |
gagtccaattactgtgatcttcaaaatcaatgaaataggagataaaatgattaacactaaatcttaccattgctccatagaagaccaaatatattgagac |
33298725 |
T |
|
| Q |
120 |
cactagctttacctatgaaaaattttcaagtagtatatgagattcaatgatagactcaaaaaatagtcaaatgaatgtggcatagcaagaaacattgttc |
219 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
33298724 |
cactagctttacctatgaaaaattttcaagtagtatatgagattcaatgatagactcaaaaaatagtcaaatgaatgtgacatagcaagaaacattgttc |
33298625 |
T |
|
| Q |
220 |
atct |
223 |
Q |
| |
|
|||| |
|
|
| T |
33298624 |
atct |
33298621 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 87 - 140
Target Start/End: Complemental strand, 33317940 - 33317887
Alignment:
| Q |
87 |
cattgctccatagaagaccaaatatattgagaccactagctttacctatgaaaa |
140 |
Q |
| |
|
||||||| |||||| |||||||||||| |||||||||||||||||| |||||| |
|
|
| T |
33317940 |
cattgctgtatagaataccaaatatattaagaccactagctttacctttgaaaa |
33317887 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University